【病毒外文文獻】2004 Characterization of a Unique Group-Specific Protein (U122) of the Severe Acute Respiratory Syndrome Coronavirus

《【病毒外文文獻】2004 Characterization of a Unique Group-Specific Protein (U122) of the Severe Acute Respiratory Syndrome Coronavirus》由會員分享，可在線閱讀，更多相關《【病毒外文文獻】2004 Characterization of a Unique Group-Specific Protein (U122) of the Severe Acute Respiratory Syndrome Coronavirus（9頁珍藏版）》請在裝配圖網上搜索。

JOURNAL OF VIROLOGY July 2004 p 7311 7318 Vol 78 No 14 0022 538X 04 08 00H110010 DOI 10 1128 JVI 78 14 7311 7318 2004 Copyright 2004 American Society for Microbiology All Rights Reserved Characterization of a Unique Group Specific Protein U122 of the Severe Acute Respiratory Syndrome Coronavirus Burtram C Fielding 1 Yee Joo Tan 1 Shen Shuo 1 Timothy H P Tan 1 Eng Eong Ooi 2 Seng Gee Lim 1 3 Wanjin Hong 1 and Phuay Yee Goh 1 Collaborative Anti Viral Research Group Institute of Molecular and Cell Biology Singapore 117609 1 Environmental Health Institute National Environmental Agency Singapore 117610 2 and Department of Medicine National University Hospital Singapore 119074 3 Republic of Singapore Received 12 February 2004 Accepted 11 March 2004 A novel coronavirus CoV has been identified as the etiological agent of severe acute respiratory syndrome SARS The SARS CoV genome encodes the characteristic essential CoV replication and structural proteins Additionally the genome contains six group specific open reading frames ORFs larger than 50 amino acids with no known homologues As with the group specific genes of the other CoVs little is known about the SARS CoV group specific genes SARS CoV ORF7a encodes a putative unique 122 amino acid protein desig nated U122 in this study The deduced sequence contains a probable cleaved signal sequence and a C terminal transmembrane helix indicating that U122 is likely to be a type I membrane protein The C terminal tail also contains a typical endoplasmic reticulum ER retrieval motif KRKTE U122 was expressed in SARS CoV infected Vero E6 cells as it could be detected by Western blot and immunofluorescence analyses U122 is localized to the perinuclear region of both SARS CoV infected and transfected cells and colocalized with ER and intermediate compartment markers Mutational analyses showed that both the signal peptide sequence and ER retrieval motif were functional An outbreak of atypical pneumonia severe acute respiratory syndrome SARS is thought to have originated from Guang dong Province Republic of China in late 2002 The mortality rate of individuals suffering from SARS can be as high as 15 1 depending on the age group analyzed A novel coronavirus CoV has recently been shown to fulfill all of Koch s postu lates as the primary aetiological agent of SARS including outcomes of monkey trials 5 13 SARS CoV contains a ge nome of H1101129 7 kbs that encodes the usual CoV replication and structural proteins CoVs are positive sense RNA enveloped viruses that con tain genomes of about 30 kb 9 Traditionally the CoVs are divided into three groups that include the mammalian viruses in groups 1 and 2 and avian viruses in group 3 The viruses are further classified into species within each group based on host range antigenic relationships and genomic organization 20 All known CoVs have a common set of essential genes encoding nonstructural proteins involved in replication repli case gene 1ab and structural proteins nucleocapsid mem brane M envelope E and spike S that are assembled into viral particles 10 Interspersed among these genes are group specific open reading frames ORFs the majority of whose functions have yet to be established Research on the possible functions of these genes has been limited but they appear to be nonessential accessory genes in cell culture 3 Inactivation of group specific mouse hepatitis virus ORF4 did not affect growth kinetics or cytopathogenicity indicating that it is not required for growth in cell culture 18 Interestingly however deletion of the nonessential genes from the mouse hepatitis virus genome resulted in attenuated viruses when inoculated into their natural hosts 3 indicating a possible in vivo func tion On the other hand Shen et al 22 showed that contin uous passage of infectious bronchitis virus IBV in cells re sulted in mutations in the 3b gene of IBV These mutations resulted in a growth advantage in cells and chicken embryos as well as in an increase in virulence in the embryos Most CoVs are fairly host specific sometimes causing severe upper respiratory or intestinal disease in the host species 9 14 The human CoVs found in both groups 1 and 2 cause about 30 of colds in humans but rarely cause lower respira tory tract disease 9 Sequence analyses indicate that SARS CoV is distinct from all known CoVs Initial reports concluded that SARS CoV did not belong to any of the three existing CoV groups 16 20 More recent phylogenetic analysis how ever has identified SARS CoV as distantly related to members of the group 2 CoVs 23 This study reports the characterization of the SARS CoV group specific gene product encoded by ORF7a also known as ORFX4 or ORF8 Fig 1 16 20 23 which we refer to as U122 designating a unique protein of 122 amino acids aa To understand the role if any that U122 plays in the infectivity of SARS CoV characterization of the gene and its product is required Sequence analysis predicted a 122 aa polypeptide with a putative signal peptide sequence C terminus transmem brane domain and short cytoplasmic tail containing the endo plasmic reticulum ER retrieval motif KRKTE Fig 2A Using Western blot and immunofluorescence we show that U122 was expressed in SARS CoV infected cells The initial characterization of the localization and processing of U122 is presented in this paper Additionally mutational analysis was used to characterize the putative signal peptide and ER re Corresponding author Mailing address Institute of Molecular and Cell Biology Collaborative Anti Viral Research Group 30 Med ical Dr Singapore 117609 Republic of Singapore Phone 65 68743780 Fax 65 67791117 E mail mcbtanyj imcb a star edu sg 7311 trieval sequences Further work to determine if U122 performs an essential function in viral replication and pathogenesis will be carried out MATERIALS AND METHODS Viruses and cells lines African green monkey kidney fibroblast Vero E6 cells American Type Culture Collection Manassas Va were maintained in complete Dulbecco s modified Eagle medium Gibco containing 10 fetal calf serum HyClone Laboratories 100 U of penicillin per ml and 100 H9262gof streptomycin Sigma per ml SARS CoV strain SIN2774 21 was used to infect subconfluent Vero E6 plates at a multiplicity of infection of 0 1 Subsequently cells were harvested at the desired cytopathic effect CPE and total proteins were extracted 24 IBV infected Vero E6 cell lysates were used as negative controls as indicated Raising antibodies to U122 The cDNA encoding aa 16 to 111 was cloned into pGEX 4T 1 and transformed into Escherichia coli BL21 DE3 cells These cells were induced to express U122 aa 16 to 111 with IPTG isopropyl H9252 D thioga lactopyranoside and allowed to grow for4hat37 C Glutathione transferase fusion proteins were purified and the preparation was injected into mice for raising polyclonal antibodies 25 After four injections the mice were bled and the sera were tested for reactivity to U122 The antibodies showed specific reactivity to U122 expressed in Vero E6 cells infected with the SARS virus or transfected with a U122 expression construct Fig 2B and C Construction of plasmids and mutations cDNAs were cloned into pXJ40 3H11032HA GLAXO Group Institute of Molecular and Cell Biology Singapore Republic of Singapore for the expression of untagged proteins in mammalian cells all constructs were untagged All forward primers used were designed to incorporate a Kozak sequence To create untagged proteins all reverse primers with the exception of mutL14 18R contained the translation stop codon The full length 366 bp SARS CoV ORF7a was amplified by PCR by using forward primer U122F1 5H11032 CGGGATCCACCATGGGAATGAAAAT 3H11032 and reverse primer U122R2 5H11032 CCGCTCGAGTCATTCTGTCTT 3H11032 incorporating BamHI and XhoI endonuclease restriction sites underlined respectively The amplicon was purified digested and cloned into the compatible restriction sites of the expression vector to form pXJU122 To mutate the U122 signal peptide cleavage site the amino acids SCELY located at positions 14 to 18 were mutated to leucines LLLLL by a two step PCR directed mutagenesis approach 27 using plasmid pXJU122 as a template Briefly the overlapping primer set consisting of forward primer mutL14 18F 5H11032 GTATTTACATTGTTGCTGCTACTTCACT ATCAGGAG 3H11032 and reverse primer mutL14 18R 5H11032 CCTGATAGTGAAGT AGCAGCAACAATGTAAATACAATC 3H11032 containing the incorporated muta tions underlined were used in combination with primers U122F1 and U122R2 to create amplicon U122 L The amplicon was purified digested and cloned in the vector to create pXJU122L Plasmid pXJmatU122 consisting of residues 16 to 122 was constructed by using PCR with forward primer U122F2 5H11032 CGGG ATCCATGGAGCTATATCACT 3H11032 and reverse primer U122R2 the BamHI restriction site is underlined and the incorporated ATG is indicated in bold To study the signal retrieval motif the lysine residues in the 3H11032 terminal amino acids KRKTE at positions 118 and 120 were mutated to glutamic acid residues This was done by using PCR with forward primer U122F1 and reverse primer U122RKH11022E 5H11032 CCGCTCGAGTCATTCTGTCTCTCTCAAT 3H11032 the XhoI re striction site is underlined This construct pXJU122KH11022E expresses the un tagged retrieval mutant All sequences were confirmed by DNA sequencing In vitro transcription and translation A total of 0 5 H9262g of plasmid pXJU122 was transcribed and translated by using the TNT T7 coupled reticulocyte lysate system Promega in a 10 H9262l reaction mixture for 1 5 h at 30 C 35 S cysteine H110221 000Ci mmol NEN was used to label U122 and samples were immunopre cipitated by using U122 specific antibodies with protein A Sepharose Proteins were resolved on sodium dodecyl sulfate SDS 15 polyacrylamide gel elec trophoresis PAGE gels and visualized by radioautography with Amplify re agent Amersham Transfection pulse chase radiolabeling and immunoprecipitation The trans fection of recombinant plasmids was accomplished by using liposomes Lipo fectamine 2000 reagent Invitrogen Generally for a 6 cm plate 0 5 H9262gof plasmid DNA was used for transfection according to the manufacturer s protocol For pulse chase experiments 2 0 H9262g of plasmid DNA was used for transfection per 6 cm plate At 6 h posttransfection confluent Vero E6 cells were starved for 30 min in prewarmed depletion medium lacking methionine and cysteine The depletion medium was replaced with medium containing 100 H9262Ci of 35 S methi onine cysteine mix per ml EXPRE 35 S 35 S protein labeling mix NEN for 10 or 30 min 35 S cysteine 100 H9262Ci NEN was used to supplement the 35 S methi onine cysteine mix to enhance the labeling efficiency Subsequently the cells were washed and chased with complete Dulbecco s modified Eagle medium containinga5mMconcentration of unlabeled methionine and cysteine Radio immunoprecipitation assay RIPA 1H11003 buffer was used to extract proteins and immunoprecipitation was done with protein A Sepharose coupled antibodies as described by Nguyen and Hogue 17 Proteins were resolved by SDS 15 PAGE and gels were fixed and treated with Amplify fluorographic reagent Amersham Subsequently gels were dried and visualized by radioautography The amount of labeled U122 was quantified by using a Bio Rad model GS 700 imaging densitometer with Bio Rad Multi Analyst version 1 02 Mac software number of radioautographs quantified for each experiment 2 Immunofluorescence of SARS CoV infected and transfected cells SARS CoV infected Vero E6 cells were grown on coverslips until they showed a CPE of 25 24 The coverslips were fixed in acetone for 20 to 30 min on ice and then air dried before being stored at H1100220 C Before use the coverslips were fixed again in methanol at H1100220 C and air dried For transfected proteins Vero E6 cells were grown on coverslips and transfected as described above An immunofluo rescence assay was performed at about 16 h posttransfection as described by Goh et al 7 Briefly the medium was removed and the coverslips were fixed in methanol for 5 min at H1100220 C after which the coverslips were lifted out and completely air dried To decrease background staining mouse anti U122 sera were adsorbed against fixed Vero E6 cells Uninfected cells showed no back ground staining with absorbed mouse anti U122 Fig 2C Mouse anti U122 was used at a dilution of 1 200 and all other antibodies were used at dilutions of 1 100 Fixed cells were incubated with the appropriate primary antibody combi nation of mouse anti U122 and rabbit anti GS28 Golgi marker BD Singapore Republic of Singapore or rabbit anti Sec31 intermediate compartment marker Sec31 HWJ Group Institute of Molecular and Cell Biology Singapore Repub lic of Singapore Following washing cells were incubated with the secondary antibody combination of fluorescein isothicyanate FITC conjugated goat anti mouse and rhodamine Rh conjugated antirabbit antibodies Santa Cruz Bio chemicals When cells were double labeled with mouse anti U122 and rat anti GRP94 fixed cells were sequentially incubated with rat anti GRP94 ER marker ITS Science and Medical Singapore Republic of Singapore and FITC conju gated anti rat secondary antibody followed by incubation with mouse anti U122 and subsequently in Rh conjugated antimouse Santa Cruz Biochemicals This was done to minimize the cross reaction of secondary antibodies with both the primary antibodies RESULTS AND DISCUSSION U122 expressed in SARS CoV infected cells Sequence anal ysis of the SARS CoV protein translated from ORF7a is pre FIG 1 Genome organization of SARS CoV ORFs encoding the nonstructural proteins black boxes as well as ORFs encoding the structural polypeptides gray boxes are indicated Also selected ORFs encoding for putative accessory genes unshaded boxes are shown ORF7a also called ORFX4 and ORF8 encoding peptide U122 is represented by the striated box The ORFs shown are labeled according to Snijder et al 23 S spike N nucleocapsid 7312 FIELDING ET AL J VIROL dicted to be a 122 aa polypeptide containing a signal peptide at the N terminus a transmembrane domain and a retrieval signal at the C terminus 16 20 Fig 2A To determine if U122 was expressed in SARS CoV infected Vero E6 cells cells were infected with SARS CoV strain SIN2774 as described in Materials and Methods Total pro teins were harvested from Vero E6 cells showing 25 and 50 to 75 CPE and subjected to Western blotting No signal was detected in mock infected cells or IBV infected cells Fig 2B lanes 1 and 5 indicating the specificity of the mouse antibody against U122 By using our mouse anti U122 antiserum the protein was only detected in SARS CoV infected cells at a CPE of 50 to 75 Fig 2B lane 3 and in Vero E6 cells transfected with a U122 DNA construct Fig 2B lane 4 Two FIG 2 U122 is expressed in SARS CoV infected Vero E6 cells A Analysis of the U122 putative sequence predicts a signal peptide sequence underlined at the N terminus the cleavage site of which is indicated with an arrow A putative membrane spanning domain boxed and an ER retrieval motif bold italics are found at the C terminus B Blots of Vero E6 cells probed with mouse anti U122 antiserum Lane 1 20 H9262gof protein from uninfected cells lanes 2 and 3 20 H9262g samples of proteins from SARS CoV infected cells harvested at about 25 CPE and 50 to 75 CPE respectively lane 4 15 H9262g of total protein from cells transfected with pXJU122 plasmid lane 5 20 H9262g of total lysate from an IBV infected cell culture C Uninfected and virus infected cells at 25 CPE were fixed and stained with mouse anti U122 antibody WB Western blot mH9251U122 mouse anti U122 antibody VOL 78 2004 SARS CoV UNIQUE PROTEIN U122 7313 bands of about 15 5 and 15 0 kDa were detected in SARS CoV late infected cells lane 3 75 CPE but a larger band of H1101117 5 kDa and a band of H1101115 0 kDa were detected in transient transfected cells expressing untagged U122 lane 4 In SARS CoV infected cells the immature U122 may have been pro cessed efficiently so that the immature form was not observed in infected cells There appeared to be an additional band slightly larger than the mature form indicating an intermedi ate form only present in virus infected cells U122 was not detected in the early phase of infection lane 2 25 CPE even when the total protein of the sample with a 25 CPE that was used for Western blotting and immunodetection was dou ble that of the sample with a 75 CPE data not shown Immunofluorescence was used to determine the cellular lo calization of U122 in SARS CoV infected cells By using mouse anti U122 antibody the protein was detected in SARS CoV infected Vero E6 cells Fig 2C U122 was detected in the perinuclear region and associated with ER This cellular localization is similar to that observed in U122 expressing Vero E6 cells see Fig 5 We do not understand why U122 was clearly detected by immunofluorescence in infected cells at 25 CPE but not in Western blots of total proteins from cells at 25 CPE The antibodies may have stronger affinity to conformational epitopes present in cells than to linear epitopes that are present in denatured proteins on Western blots SARS CoV U122 protein in transfected cells The SARS CoV genome contains five group specific ORFs larger than 50 amino acids 16 20 SARS CoV proteins excluding the rep lication gene products of ORF 1ab are translated from a set of 5H11032 nested subgenomic mRNAs sgmRNAs Each sgmRNA contains a 5H11032 end derived from the genomic 5H11032 leader sequence subgenomic sequences and a common 3H11032 end 8 20 26 Between five and eight SARS CoV sgmRNAs are detected by Northern hybridization analysis from infected cells ranging from 8 3 to 1 7 kb in size 20 23 This includes a polycistronic 2 5 kb mRNA that contains a conserved transcription regula tion sequence immediately upstream of ORF7a This indicates that ORF7a is likely to be translated 20 to give U122 To express untagged SARS CoV U122 in vitro full length ORF7a was cloned into mammalian expression vector pXJ40 3H11032HA to form pXJU122 Untagged U122 was translated in vitro by using the TNT coupled reticulocyte lysate system Pro mega in the presence of 35 S cysteine Following immunopre cipitation with antibodies specific for U122 a single H1101117 5 kDa band was observed Fig 3A To detect U122 expressed in Vero E6 cells total proteins on Western blots were probed with mouse anti U122 Two bands of about 17 5 and 15 0 kDa were observed Fig 3B lane 3 The smaller protein band could be due to proteolytic cleavage of the signal peptide and was not observed in the in vitro translated product even with the addition of canine microsomal membranes data not shown indicating the possible need for additional host cofac tor s for efficient processing of U122 The putative SARS CoV U122 signal sequence Since the deduced SARS CoV U122 amino acid sequence contains a putative signal peptide sequence of 15 residues 16 we spec ulated that the smaller H1101115 0 kDa product was due to cleavage of the signal peptide from the larger H1101117 5 kDa protein Signal peptides play a major role in membrane integration and the translocation of secretory and membrane proteins from the ER 4 Many enveloped virus glycoproteins are synthesized as inactive precursors which are usually unable to mediate mem brane fusion and hence viral entry 28 Therefore the endo proteolytic cleavage of viral envelope glycoproteins is crucial for virus maturation and the availability of cellular enzymes capable of processing the inactive precursors can be major determinants of viral tropism and pathogenicity 15 28 To determine whether the SARS CoV signal peptide sequence is active we used PCR directed mutagenesis to create two mu tations in U122 one in the cleavage site of the putative signal peptide and the other to delete the N terminal signal peptide up to the cleavage site Mutation of the residues spanning the predicted cleavage site residues SCELY at positions 14 to 18 to leucines U122 L abolished t