【病毒外文文獻】2016 Bat SARS-like coronavirus WIV1 encodes an extra accessory protein ORFX involved in modulation of host immune respon

《【病毒外文文獻】2016 Bat SARS-like coronavirus WIV1 encodes an extra accessory protein ORFX involved in modulation of host immune respon》由會員分享，可在線閱讀，更多相關《【病毒外文文獻】2016 Bat SARS-like coronavirus WIV1 encodes an extra accessory protein ORFX involved in modulation of host immune respon（41頁珍藏版）》請在裝配圖網上搜索。

1 Bat SARS like coronavirus WIV1 e ncodes an extra accessory protein ORFX 1 involved in modulation of host immune response 2 Lei Ping Zeng 1 Yu Tao Gao 1 Xing Yi Ge 1 Qian Zhang 1 Cheng Peng 1 Xing Lou 3 Yang 1 Bing Tan 1 Jing Chen 1 Aleksei A Chmura 2 Peter Daszak 2 Zheng Li Shi 1 4 5 6 1 Key Laboratory of Special Pathogens Wuhan Institute of Virology Chinese 7 Academy of Sciences Wuhan 430071 China 8 2 EcoHealth Alliance 460 West 34 th Street New York NY10001 USA 9 10 Running title SL CoV ORFX 11 12 Keywords SARS like coronavirus ORFX reverse genetics interferon antagonist 13 NF B activation 14 15 Word counts 4823 for main text 174 for abstract 16 17 Correspondence Zheng Li Shi zlshi Key Laboratory of Special 18 Pathogens and Biosafety Wuhan Institute of Virology Chinese Academy of Sciences 19 Wuhan 430071 China Tel 86 27 87197240 20 21 JVI Accepted Manuscript Posted Online 11 May 2016 J Virol doi 10 1128 JVI 03079 15 Copyright 2016 American Society for Microbiology All Rights Reserved 2 Abstract 22 Bats harbor severe acute respiratory syndrome like coronaviruses SL CoVs from 23 which the causative agent of the 2002 3 SARS pandemic is thought to have originated 24 However despite a large number of genetically diverse SL CoV sequences detected 25 in bats only two strains named WIV1 and WIV16 have been successfully cultured 26 in vitro These two strains differ from SARS CoV only in containing an extra ORF 27 named ORFX between ORF6 and ORF7 with no homology to any known protein 28 sequences In this study we constructed a full length cDNA clone of SL CoV WIV1 29 rWIV1 an ORFX deletion mutant rWIV1 X and a GFP expressing mutant 30 rWIV1 GFP X Northern blot and fluorescent microscopy indicate that ORFX was 31 expressed during WIV1 infection Virus infection assay showed that rWIV1 X 32 replicated as efficiently as rWIV1 in Vero E6 Calu 3 and HeLa hACE2 cells 33 Further study showed that ORFX could inhibit interferon production and activates 34 NF B Our results demonstrate for the first time that the unique ORFX in the WIV1 35 strain is a functional gene involving modulation of host immune response but not 36 essential for in vitro viral replication 37 3 Importance 38 Bats harbor genetically diverse SARS like coronaviruses SL CoVs and some of 39 them have the potential of interspecies transmission A unique open reading frame 40 ORFX was identified in the genome of two recently isolated bat SL CoV strains 41 WIV1 159 reverse 5 cctgactgcaggtcgactgccgcggagctctgcttatatagacc 3 Hepatitis delta virus 160 HDV ribozyme was synthesized as described 26 and amplified with primers 161 forward 5 cagtcgacctgcagtcaggcgcgccgggtcggcatggcatctcc 3 reverse 162 9 5 ctagaaggcacagctcccttagccatccgagtgg 3 Bovine growth hormone BGH 163 transcription terminal signal was amplified from pcDNA3 1 with primers forward 164 5 ggatggctaagggagctgtgccttctagttgccagc 3 reverse 165 5 tgaaagcttccatagagcccaccgcatcc 3 Then the three PCR products were ligated 166 using OE PCR with BamHI and HindIII sites flanking the amplicon and SacII and 167 AscI sites sitting between CMV promoter and HDV ribozyme The amplicon was 168 then inserted into pBeloBAC11 New England BioLabs between BamHI and HindIII 169 sites The construct was designated pBAC CMV 170 171 Construction of infectious BAC clones of WIV1 The subclone A and subclone G 172 were first digested with SacII and AscI New England BioLabs respectively 173 followed by treatment with CIAP Takara chloroform extraction and isopropanol 174 precipitation and then restricted with BglI Takara The subclones B F were digested 175 with BglI pBAC CMV was digested with SacII and AscI All digestion products 176 were then separated using 1 agarose gels excised and purified by using the Gel 177 Extraction Kit Omega Digested fragments A G and pBAC CMV were ligated 178 overnight at 4 C transformed into DH10B competent cells and plated on Chl LB 179 culture Ten clones were screened by RFLP analysis with NcoI StuI or HindIII The 180 correct clone was named as pBAC CMV rWIV1 Fig 1 181 182 10 Construction of WIV1 mutants To delete ORFX the fragment F was 183 PCR amplified with primer set FF 5 acctgtgcccttttggcgaggtttttaatgctactac 3 and 184 RFox 5 gcctctagggctcaaggataatctatctccatagg 3 The fragment G was 185 PCR amplified with FGox 5 gccctagaggcaacgaacatgaaaattattctcttcc 3 and RG 5 186 actggcgcgcctttttttttttttttttttttttttgtcattctcctgagaagc 3 This new fragment is named as 187 Gox These two products were then cloned into pGEM T EASY The two fragments 188 were inserted into BAC along with the other fragments as described above The 189 rescued mutant was named as rWIV1 X To replace GFP into the open reading 190 frame of ORFX the F fragment was amplified with primer set FF and RFoeGFP 191 5 gctcaccatagtggttcgtttatcaaggataatctatctcc 3 The GFP gene was amplified with a 192 primer set 5 ccttgataaacgaaccactatggtgagcaagggcgaggagc 3 and 193 5 tgcctctagggcttacttgtacagctcgtccatgcc 3 The two PCR products were ligated by 194 OE PCR and the product was inserted into pGEM T EASY The rescued mutant was 195 named as rWIV1 GFP X 196 197 Transfection of infectious WIV1 BAC clones Vero E6 cells were seeded in a 6 well 198 plate a day in advance and then one well was transfected with 6 g infectious BAC 199 plasmids constructed as above with Lipofectamine LTX and Plus Reagent Life 200 technologies Virus progeny was plaque purified once One clone was passaged once 201 in Vero E6 cells for 72 h and used to generate a stock for future use 202 203 11 Restriction fragment length polymorphism RNA extracted from wild type and 204 recombinant viruses were reverse transcribed with random hexamer primers RT PCR 205 was used to generate five amplicons containing the five mutations designed in the 206 strategy These amplicons included a 1124 bp amplicon nucleotide positions 207 1312 2435 spanning a naturally occurring BglI site at nucleotide 1571 that had been 208 ablated in recombinant viruses a 1438 bp amplicon spanning the B C1 junction 209 nucleotide positions 7560 8997 a 1437 bp amplicon spanning the C1 C2 junction 210 nucleotide positions 10196 11632 a 1437 bp amplicon spanning the D E junction 211 nucleotide positions 16793 18229 and a 1438 bp amplicon spanning the E F 212 junction nucleotide positions 21908 23345 These amplicons correspond to 213 fragment F1 F5 in Fig 1 The first amplicon of wild type WIV1 that contains 214 nucleotide 1571 can be cleaved by BglI but the other four amplicons cannot In 215 contrast the five amplicons of recombinant viruses are different to those of wild type 216 virus in the capability of being cut by BglI 217 218 Northern blot analysis The N gene was amplified with primers WIV1 NF 219 5 atgtctgataatggacccca 3 and WIV1 3R 5 gtcattctcctgagaagcta 3 and used as a 220 template for probe preparation according to the description of DIG High Prime DNA 221 Labeling and Detection Starter Kit II Roche Vero E6 cells were infected with 222 wild type and recombinant viruses at an MOI of 1 0 At 24 h postinfection 223 intracellular RNA was isolated using TRIzol reagent Ambion RNA 20 g was 224 12 precipitated treated with 17 L Sample Buffer 50 Formamide 2 2 M 225 Formaldehyde 37 1 MOPS at 65 C for 10 min added with 3 L 10 Dye 226 Solution 50 glycerol 0 25 Bromophenol Blue 0 25 Xylene Cyanole FF and 227 then separated in denaturing 0 8 agarose 2 2 M formaldehyde gel at 28 V for 17 h 228 The RNA was hydrolyzed by 0 05 M NaOH for 40 min transferred to a Hybond N 229 membrane GE Healthcare for 18 h and then cross linked to the membrane using 230 UV light The membrane was prehybridized probed with a DIG labelled probe for N 231 gene washed and detected according to the DIG High Prime DNA Labeling and 232 Detection Starter Kit II Roche 233 234 RT PCR of leader containing transcripts Intracellular RNA was isolated from 235 wtWIV1 A forward primer Leader F located in the leader sequence along with 236 various reverse primers located in several ORFs was used for amplifying 237 leader containing sequences primer sequences available upon request 238 Leader containing amplicons were sequenced with the corresponding reverse primers 239 240 ORFX subcellular location HeLa cells were transfected with ORFX expressing 241 plasmid and cotransfected with organelle markers expressing plasmids SecG1 GFP 242 B4Gal Ti RFP or Mito YFP After 24 h the cells were fixed and stained with a 243 mouse anti HA IgG Promoter A Cy3 conjugated goat anti mouse IgG Promoter 244 was used for secondary detection in cells expressing ER or mitochondrial markers An 245 13 FITC conjugated goat anti mouse IgG Promoter was used for secondary detection in 246 cells expressing Golgi marker Nuclei were stained with 247 4 6 diamidino 2 phenylindole DAPI Staining patterns were examined with an 248 Olympus Fluoview upright confocal microscope Olympus 249 250 Luciferase assays and quantitative PCR For ORFX mediated IFN promoter assay 251 293T cells were seeded in 12 well plates and cotransfected with empty vector plasmid 252 pCAGGS plasmid pCAGGS NS1 or escalating amount 100 200 400 600 800 ng 253 of pCAGGS ORFX with the indicated reporter plasmids At 24 h posttransfection 254 cells were infected with SeV 100 hemagglutinin units ml for 12 h to induce IFN 255 production or treated with TNF for 1 h to activate NF B Cell lysates were 256 prepared and luciferase activity was measured using the Dual Luciferase Assay kits 257 Promega according to the manufacturer s instructions 258 293T cells were transfected with empty vector NS1 expressing plasmid or 259 escalating amount 100 300 600 ng of ORFX expressing plasmid After 24 h the 260 cells were infected with SeV 100 HAU ml At 12 h postinfection the cells were 261 lysed The mRNA was extracted and reverse transcribed with PrimeScript RT Master 262 Mix Takara The expression level of IFN mRNA was determined by 263 quantification PCR using SYBR Premix Ex Taq II Takara The GAPDH mRNA was 264 quantified as an inner control 293T cells were transfected as above After 24 h the 265 cells were treated with TNF for 6 h the cell RNA was extracted and used for 266 14 quantification of the expression of IL8 mRNA All experiments were performed in 267 triplicate and repeated at least three times All primer sequences used in the 268 quantitative PCRs will be provided upon request 269 270 IRF3 translocation assay 293T cells were transfected with empty vector NS1 or 271 ORFX expressing plasmid After 24 h IRF3 nuclear translocation was induced by 272 infecting the cells with SeV for 8 h The cells were fixed and stained with a rabbit 273 anti IRF3 polyclonal IgG Proteintech and a mouse anti HA IgG Promoter An 274 Alexa Fluor 488 conjugated donkey anti rabbit IgG Yeasen and an Alexa Fluor 555 275 conjugated donkey anti mouse IgG Beyotime were used to detect IRF3 and ORFX 276 respectively The cells transfected with empty vector were stained with a rabbit 277 anti IRF3 polyclonal IgG and a goat anti SeV IgG kindly provided by Prof Lin Fa 278 Wang at the Duke NUS Graduate Medical School Singapore as an indication of 279 infection efficiency An Alexa Fluor 488 conjugated donkey anti rabbit IgG and a 280 Cy3 conjugated donkey anti Goat IgG Promoter were used to detect IRF3 and SeV 281 respectively Nuclei were stained with DAPI 282 283 Quantification of mRNA expression of cytokines in infected Calu 3 cells Calu 3 284 cells grown in 24 well plates were mock infected or infected with rWIV1 or 285 rWIV1 X at an MOI of 5 or SeV 100 HAU ml The cells were lysed at 4 12 24 286 and 30 h postinfection The mRNA expression level of IFN IL6 IL8 and TNF 287 15 was quantified by quantitative PCRs The expression of GAPDH mRNA was 288 measured as an inner control All primer sequences used in the quantitative PCRs will 289 be provided upon request The experiment was performed twice 290 291 IFN sensitivity assay Vero E6 cells were seeded a day in advance The cells were 292 pretreated with 10 100 or 1000 U ml IFN PBL Piscataway NJ for 24 h infected 293 with wtWIV1 rWIV1 and rWIV1 X at an MOI of 0 1 PFU cell and post treated 294 with the same amount of IFN as used previously At 24 h postinfection the viral 295 replication was analyzed by plaque assay The experiment was performed in triplicate 296 297 Statistics The statistical significance of the obtained data was analyzed using a 298 student s t test in GraphPad Prism GraphPad Software San Diego CA A p value 299 0 05 was considered statistically significant Data is presented as the means SEM 300 301 Results 302 Strategy for construction of an infectious WIV1 BAC Originally the genome was 303 split into seven contiguous cDNAs A G Fig 1 A and C Due to the plasmid 304 instability fragment C was separated into two segments C1 and C2 Besides three 305 naturally occurring BglI GCCNNNN NGGC sites four BglI sites were successfully 306 introduced by synonymous mutations in the genome Fig 1 B Different asymmetric 307 3 nt overhangs at the junctions of each two contiguous fragments were created by 308 16 these BglI sites The eight fragments were then linked in one direction A SacII site 309 was added to the 5 terminus of fragment A A poly A sequence 25 nt and an AscI 310 site were added to the 3 terminus of fragment G A naturally occurring BglI site at 311 nucleotide 1571 was removed by synonymous mutations C1575A Fig 1B Other 312 unexpected synonymous mutations also occurred including T1422C T12984C 313 T14213C T17130C C17934T and T26068G 314 The plasmid pBAC CMV was constructed by inserting with the cytomegalovirus 315 CMV promoter hepatitis delta virus HDV ribozyme and bovine growth hormone 316 BGH transcription terminal signal sequences into pBeloBAC11 along with the 317 introduction of the SacII and AscI sites between CMV promoter and HDV ribozyme 318 Fig 1 C The eight genomic fragments were inserted into pBAC CMV in one step 319 Recombinant viruses could be rescued by direct transfection with the BAC constructs 320 321 Rescue of recombinant viruses To rescue recombinant WIV1 rWIV1 fragments 322 A and G were digested with SacII and AscI respectively Following calf intestinal 323 alkaline phosphatase CIAP dephosphorylation the two fragments along with 324 fragments B F were digested using BglI and inserted into pBAC CMV between SacII 325 and AscI sites in one step The constructed clone pBAC CMV rWIV1 was 326 transfected into Vero E6 cells Cytopathic effect was observed at 72 h posttransfection 327 The one ablated natural BglI site and four introduced BglI sites in the rescued viral 328 genome were confirmed by restriction fragment length polymorphism RFLP 329 17 analysis with BglI digestion Fig 2 A Using this method we also rescued an ORFX 330 deletion mutant virus rWIV1 X Fig 2 B lane 2 and a mutant with GFP replaced 331 into the coding region of ORFX rWIV1 GFP X Fig 3 A 332 333 ORFX is a functional gene not essential for virus replication The one step growth 334 curve of the two rescued recombinant viruses rWIV1 X and rWIV1 and wild type 335 WIV1 wtWIV1 determined by plaque assay showed that rWIV1 X and rWIV1 336 both replicated to the titers close to wild type virus Fig 2 C The expected set of 337 appropriately sized 10 sgRNAs including sgRNA7 ORFX were observed in 338 Northern blot analysis in cells infected with wtWIV1 and rWIV1 Fig 2B lane 1 and 339 lane 3 As expected sgRNA7 was not observed in rWIV1 X infected cells Fig 2 340 B lane 2 Analysis of leader containing sequences indicated that all 10 sgRNA in 341 wtWIV1 share an identical core sequence ACGAAC Table 1 which further 342 confirmed that ORFX is expressed as sgRNA7 The GFP was expressed in 343 rWIV1 GFP X infected cells further confirmed that the open reading frame of 344 ORFX could be expressed Fig 3 A Subcellular location analyses showed that the 345 ORFX protein colocalized with the ER marker but not with the Golgi and 346 Mitochondria markers Fig 3 B 347 348 ORFX protein inhibits the production of IFN To determine whether ORFX 349 inhibits the induction of IFN 293T cells were transfected with plasmids pIFN Luc 350 18 and pRL TK and the plasmid expressing ORFX influenza virus strain PR8 NS1 351 positive control or empty vector negative control As expected SeV activated IFN 352 production in cells transfected with empty vector The positive control influenza 353 virus NS1 protein dramatically inhibited the expression from the IFN promoter 354 ORFX protein exhibited inhibition effect but the effect decreased while more ORFX 355 protein was expressed Fig 4 A Similar results were observed for IFN mRNA 356 quantification Fig 4 B and C 357 IRF3 nuclear translocation assay was performed to see whether ORFX protein 358 inhibits IFN production through inhibiting this process 293T cells were transfected 359 with empty vector NS1 or ORFX expressing plasmid After 24 h IRF3 nuclear 360 translocation was induced by infection of SeV for 8 h The relative IRF3 translocation 361 ratios were calculated for each group by counting the number of the IRF3 nuclear 362 translocation cells randomly selected at least 4 fields divided by the number of total 363 infected or transfected cells The IRF3 nuclear translocation efficiency of each group 364 was expressed as the percentage of their relative IRF3 translocation ratios to that of 365 control cells transfected with empty vector As expected NS1 strongly inhibited 366 translocation of IRF3 While ORFX protein also showed inhibition of IRF3 367 translocation but less efficiently Fig 4 D and E 368 To further investigate the IFN inhibition activity of ORFX the deletion mutant 369 and wild type recombinant virus were used to infect Calu 3 cells at an MOI of 5 370 Mock infected cells were used as negative control Calu 3 cells infected with SeV 371 19 were used as positive control Samples were collected at 4 12 24 and 30 h 372 postinfection The relative expression of IFN mRNA was determined by 373 quantification PCR and normalized to the expression of GAPDH mRNA Compared 374 to SeV WIV1 recombinants induced low levels of IFN mRNA in Calu 3 cells Fig 375 4 F The ORFX deletion mutant induced a significantly higher level of IFN mRNA 376 than wild type recombinant virus in infected cells at 12 h postinfection but no 377 significant differences at 24 30 h postinfection Fig 4 F These results indicate that 378 ORFX protein may play a role in antagonizing IFN only in early time during WIV1 379 infection 380 381 ORFX deletion mutant shows increased sensitivity to IFN To further investigate 382 the effect of ORFX on the viral sensitivity of IFN we tested the replication 383 efficiencies of wtWIV1 rWIV1 and rWIV1 X in Vero E6 cells which were 384 pretreated and posttreated with IFN The replication of rWIV1 X was evidently 385 inhibited and reduced 0 5 logs compared to wtWIV1 and rWIV1 at a concentration 386 of 10 and 100 U ml IFN Fig 4 G Whereas at a higher IFN concentration 1000 387 U ml the titers of rWIV1 X didn t show an obvious decrease compared to wild 388 type virus We expected the ORFX deleted mutant would replicate less efficiently 389 than the wild type virus in IFN competent cells However we did not find a 390 significant difference when we grew the two viruses in Calu 3 and HeLa hACE2 cells 391 even at a very low MOI of 0 001 Fig 5 392 20 393 ORFX protein activates NF B NF B plays an important role in regulating 394 immune response to viral infection and is also a key factor frequently targeted by 395 viruses for taking over the host cell 27 Several proteins Nsp1 N and 3a encoded 396 by SARS CoV have both activities in IFN antagonizing and NF B activation 28 In 397 this study we also tested whether ORFX protein could activate NF B 293T cells 398 were transfected with pNF B Luc pRL TK and empty vector NS1 or escalating 399 amount 200 400 600 ng of ORFX expressing plasmid After 24 h the cells were 400 mock treated or treated with TNF for 6 h and luciferase activity was determined 401 ORFX protein obviously activates NF B no matter whether the cells were treated 402 with TNF or no