【病毒外文文獻(xiàn)】2009 Severe Acute Respiratory Syndrome Coronavirus nsp9 Dimerization Is Essential for Efficient Viral Growth

《【病毒外文文獻(xiàn)】2009 Severe Acute Respiratory Syndrome Coronavirus nsp9 Dimerization Is Essential for Efficient Viral Growth》由會員分享，可在線閱讀，更多相關(guān)《【病毒外文文獻(xiàn)】2009 Severe Acute Respiratory Syndrome Coronavirus nsp9 Dimerization Is Essential for Efficient Viral Growth（12頁珍藏版）》請在裝配圖網(wǎng)上搜索。

JOURNAL OF VIROLOGY Apr 2009 p 3007 3018 Vol 83 No 7 0022 538X 09 08 00H110010 doi 10 1128 JVI 01505 08 Copyright 2009 American Society for Microbiology All Rights Reserved Severe Acute Respiratory Syndrome Coronavirus nsp9 Dimerization Is Essential for Efficient Viral Growth H17188 Zachary J Miknis 1 Eric F Donaldson 2 Timothy C Umland 1 3 Ryan A Rimmer 3 Ralph S Baric 2 and L Wayne Schultz 1 3 Department of Structural Biology State University of New York at Buffalo Buffalo New York 14203 1 Department of Microbiology and Immunology University of North Carolina at Chapel Hill Chapel Hill North Carolina 27599 2 and Hauptman Woodward Medical Research Institute Buffalo New York 14203 3 Received 17 July 2008 Accepted 9 January 2009 The severe acute respiratory syndrome coronavirus SARS CoV devotes a significant portion of its genome to producing nonstructural proteins required for viral replication SARS CoV nonstructural protein 9 nsp9 was identified as an essential protein with RNA DNA binding activity and yet its biological function within the replication complex remains unknown Nsp9 forms a dimer through the interaction of parallel H9251 helices containing the protein protein interaction motif GXXXG In order to study the role of the nsp9 dimer in viral reproduction residues G100 and G104 at the helix interface were targeted for mutation Multi angle light scattering measurements indicated that G100E G104E and G104V mutants are monomeric in solution thereby disrupting the dimer However electrophoretic mobility assays revealed that the mutants bound RNA with similar affinity Further experiments using fluorescence anisotropy showed a 10 fold reduction in RNA binding in the G100E and G104E mutants whereas the G104V mutant had only a 4 fold reduction The structure of G104E nsp9 was determined to 2 6 resolution revealing significant changes at the dimer interface The nsp9 mutations were introduced into SARS CoV using a reverse genetics approach and the G100E and G104E mutations were found to be lethal to the virus The G104V mutant produced highly debilitated virus and eventually reverted back to the wild type protein sequence through a codon transversion Together these data indicate that dimerization of SARS CoV nsp9 at the GXXXG motif is not critical for RNA binding but is necessary for viral replication The discovery of a novel coronavirus CoV as the causative agent of severe acute respiratory syndrome SARS SARS CoV has highlighted the need for a better understanding of CoV replication 19 After emerging in late 2002 from the Guangdong Province in China SARS CoV was rapidly iso lated and its genome sequenced to reveal a new CoV that was phylogenetically distinct suggesting a new classification as a type IIb CoV 15 32 43 50 Genomic comparison to the closely related murine hepatitis virus MHV human CoV OC43 HCoV OC43 and bovine CoV revealed a highly con served genomic structure with many regions nearly identical 52 After strict quarantine controls were initiated SARS CoV was contained with approximately 8 000 individuals being clinically infected resulting in close to 800 deaths www who int csr sars en Recently the natural reservoir for SARS CoV was reported as the Chinese horseshoe bat indicating that i the disease is still circulating in animals and ii a future re emergence from a zoonotic source is possible underscoring the importance of continued study of this virus 36 38 CoVs devote a significant portion of their positive sense single stranded RNA ssRNA genome to proteins related to viral RNA replication SARS CoV has a genome of H1101129 700 nucleotides of which more than 21 000 code for the 16 non structural proteins nsp s 43 50 The replicase genes open reading frame 1a ORF1a and ORF1b are translated into large polyproteins pp1a 4 300 amino acids aa and through a H110021 ribosomal frameshift mechanism a fusion protein known as pp1ab 7 000 aa 58 Posttranslational processing of the polyproteins by two distinct viral proteinases the papain like proteinase and a 3C like proteinase 3CL pro also known as M pro yields 16 mature nsp s many of which interact to form the replication complex responsible for the synthesis of nega tive strand template positive strand genomic and all sub genomic RNAs sgRNA with additional roles related to cellular processes 23 30 37 52 54 68 The precise stoi chiometry of the replicase complex is unknown but yeast two hybrid screens glutathione S transferase pull down assays and X ray crystallography have revealed a number of protein pro tein interactions between the various nsps 27 60 67 In general proteins form multimers for a variety of reasons including stability allostery and to ensure accurate translation of genetic information 22 Translation of large polypeptides can result in errors in protein sequence and therefore large complexes are usually assembled from multiple small proteins Viruses both violate and adhere to this rule by first producing large polyproteins and then processing them into individual proteins that assemble to form active replication complexes For the CoVs the protein components and stoichiometry of the positive and negative strand replication complexes remain unknown Crystal structures of individual SARS CoV nsp s have revealed several different multimeric states for the same protein For example the structure of nsp10 is reported as a dimer and as a dodecamer by separate groups 29 55 al though genetic data suggest that the dodecamer structure is Corresponding author Mailing address Department of Structural Biology SUNY at Buffalo Hauptman Woodward Institute 700 Elli cott St Buffalo NY 14203 Phone 716 898 8640 Fax 716 898 8660 E mail schultz hwi buffalo edu H17188 Published ahead of print on 19 January 2009 3007 on March 7 2015 by DAHLGREN MEDICAL LIBRARY http jvi asm org Downloaded from not essential for in vitro replication 14 Biochemical studies of nsp7 and nsp8 indicate that independently they are dimeric in solution but the crystal structure of the nsp7 and nsp8 complex is a hexadecamer 67 For nsp9 there are four crys tallographic structures which report a variety of dimeric inter faces 16 49 57 In one case two interfaces are present in a single crystal form suggesting that a tetrameric complex that incorporates both interfaces may be possible Although the information provided by these structures is significant the bi ological relevance to the replication complex has not been established SARS CoV nsp9 has been shown to have RNA and DNA binding ability through a variety of methods 16 49 57 nsp9 from MHV A59 has been shown through immunofluorescence studies to localize with among others the helicase nsp13 nucleocapsid N protein and 3CL pro nsp5 4 5 nsp9 also localizes to late endosomes at sites of replication with nsp7 nsp8 and nsp10 and is likely a member of the replication complex 4 An nsp9 knockout in MHV A59 is not viable while fusion of a nsp9 10 polyprotein is viable but attenuated in growth suggesting that the mature form of nsp9 plays a critical role in viral replication 13 Several crystallographic structures of nsp9 have shown that it is composed of seven beta strands and a single alpha helix 16 49 57 The fold of nsp9 is reported to be similar in fold to domains I and II of the 3CL pro encoded within the SARS CoV genome 16 however no significant sequence similarity exists between the two The presumed biological dimer utilizes the interaction between the lone helices of each monomer to form the parallel helix helix dimer Fig 1A A second dimeric form has a beta sheet interface stabilized by main chain atom inter actions within the sheet regions of each monomer Fig 1B A recent crystal structure of HCoV 229E nsp9 reveals an antipa rallel helix helix dimer formed by a disulfide bond at Cys69 Fig 1C Upon generating a multiple sequence alignment Fig 1D of various CoV nsp9 proteins it was found that while the helix helix interface found in Fig 1A contained multiple conserved residues along the dimer interface and buried H110111 000 2 of surface exposed area the sheet sheet dimer in Fig 1B contained no conserved residues in the dimer region and buried only H11011500 2 A survey of dimer interfaces found in protein structures suggests for a protein of H1101115 kDa a buried surface area of H110111 000 2 would be expected 2 28 The common protein protein interaction motif GXXXG 20 31 is conserved at the dimer interface allowing the heli ces to closely pack at the positions of G100 and G104 Fig 1A Therefore we designed mutagenesis experiments to in vestigate the stability and function of that dimer Mutants G100E G104E and G104V were created to disrupt the di meric interface and were characterized by size exclusion chro matography SEC multi angle light scattering MALS and circular dichroism CD spectroscopy Effects on ssRNA bind ing were assessed by RNA electrophoretic mobility shift assay EMSA and fluorescence anisotropy FA The crystal struc ture of G104E was solved and refined to 2 6 resolution and changes in the helix helix interface were observed The development of reverse genetics approaches to studying CoVs has also allowed us to reintroduce the G100E G104E and G104V mutations into SARS CoV Urbani strain to study their effects on the virus in vivo 65 The G100E and G104E mutations were lethal to the virus while the G104V mutation produced a highly debilitated growth phenotype with eventual transversion of the codon at position 104 from GTG Val to GGG Gly indicating that dimerization of nsp9 at the GXXXG interface is required for efficient viral growth MATERIALS AND METHODS Mutant generation SARS CoV nsp9 pET23d H11001 plasmid containing the coding sequence of nsp9 in addition to a C terminal His 6 tag was a gift from Mark Denison Vanderbilt University Nsp9 G100E G104E and G104V FIG 1 Dimer arrangements in nsp9 A nsp9 crystal structure 1QZ8 showing presumed biological dimer and helix helix interface The individual monomers are colored in blue green and red yellow respectively The positions of G100 and G104 are depicted as space filling models for both monomers G100E and G104E are labeled in one monomer B Alternate nsp9 dimer 1UW7 stabilized through sheet regions Each monomer is colored from the N terminus blue to the C terminus red C Antiparallel helix helix dimer of HCoV 229E nsp9 stabilized by a disulfide linkage at C69 Each monomer is colored from the N terminus blue to the C terminus red D Mul tiple sequence alignment of CoV nsp9 homologs showing absolute conservation of glycines equivalent to G100 green and G104 cyan in SARS CoV Images were prepared by using PyMol 3008 MIKNIS ET AL J VIROL on March 7 2015 by DAHLGREN MEDICAL LIBRARY http jvi asm org Downloaded from mutants were generated by using a QuikChange site directed mutagenesis kit Qiagen according to the manufacturer s protocol using the following prim ers 9G100EF 5H11032 AACAACCTAAATAGAGAAATGGTGCTGGGCAGTT TAGC 3H11032 9G100ER 5H11032 GCTAAACTGCCCAGCACCATTTCTCTATTTA GGTTG 3H11032 9G104EF 5H11032 GAGGTATGGTGCTGGAAAGTTTAGCTGCTA C 3H11032 9G104ER 5H11032 GTAGCAGCTAAACTTTCCAGCACCATACCTC 3H11032 9G104VF 5H11032 GAGGTATGGTGCTGGTGAGTTTAGCTGCTAC 3H11032 and 9G104VR 5H11032 GTAGCAGCTAAACTCACCAGCACCATACCTC 3H11032 bold facing indicates sites of mutation Mutagenesis products were transformed into DH5H9251 cells Invitrogen Carlsbad CA and plated on LB agar plates supplemented with 100 H9262g of ampicillin ml from which colonies were se lected and grown in 5 ml cultures of LB supplemented with 100 H9262gof ampicillin ml Plasmid was purified by using a Qiagen spin miniprep kit according to the manufacturer s protocol The presence of the mutations within the plasmids was confirmed through DNA sequencing on an ABI Prism 3130XL genetic analyzer Roswell Park Cancer Institute Biopolymer Facility Expression and purification Plasmids were each transformed into BL21 DE3 Novagen cells and screened for expression conditions Soluble protein was obtained through the addition of IPTG isopropyl H9252 D thiogalacto pyranoside to 1 mM in 1 liter of culture grown in LB supplemented with 100 H9262g of ampicillin ml and grown to an optical density at 600 nm of H110110 6 at 37 C followed by shaking at 37 C for 3 h Cells were collected by centrifugation and stored at H1100280 C All purification steps were carried out at 4 C Cell pellets from 1 liter cultures were thawed resuspended in 15 ml of buffer A 50 mM Tris pH 8 0 300 mM NaCl 10 mM imidazole and 1 ml of protease inhibitor cocktail Roche and then lysed by using a single pass through a Microfluidizer Microfluidics Co at H1101118 000 lb in 2 The resulting lysate was centrifuged at 35 000 rpm at 4 C for 30 min in a 45 Ti rotor Beckman Supernatant was filtered 0 22 H9262m pore size and applied to a 5 ml HisTrap GE Healthcare column pre equilibrated in buffer A Protein was washed with buffer A followed by 12 buffer B 50 mM Tris pH 8 0 300 mM NaCl 300 mM imidazole and eluted from the column in a linear gradient from 12 to 100 buffer B Fractions were analyzed by sodium dodecyl sulfate polyacrylamide gel electrophoresis SDS PAGE and nsp9 con taining fractions were pooled and dialyzed against 1 liter of buffer C 10 mM Tris pH 8 150 mM NaCl 1 mM EDTA 5 mM dithiothreitol Concentrated protein was subsequently applied to a Superdex 75 HL 16 60 column pre equilibrated in buffer C Fractions were analyzed by SDS PAGE with appropriate fractions pooled and dialyzed against either 1 liter of buffer D 50 mM MES morpho lineethanesulfonic acid pH 5 6 15 mM NaCl 0 5 mM TCEP tri 2 carboxyethyl phosphine HCl or 1 liter of buffer C Final samples were stored at 4 C and assayed for protein concentration at 280 nm using an extinction coefficient of 13 075 M H110021 cm H110021 calculated by ProtParam 63 using the coding sequence of the mature nsp9 product with a C terminal tag LEHHHHHH SEC and SEC MALS Aliquots of elution fractions from immobilized metal affinity chromatography IMAC purification were applied to a Superdex 75 HR 10 30 column GE Healthcare preequilibrated in buffer E 10 mM NaPO 4 pH 8 100 mM NaCl The Superdex column was attached on an AKTA Purifier coupled with a Wyatt Systems MiniDAWN three detectors and Optilab DSP Wyatt Systems immediately downstream of the column Protein samples were applied and eluted from the column at 0 5 ml min with simultaneous collection of light scattering and refractive index data using a laser excitation wavelength of 690 nm and light scattering detectors at 45 90 and 135 Peak analysis was performed by using the ASTRA software provided with the system CD spectroscopy Protein samples were passed over a Superdex 75 HL 16 60 column in buffer F 25 mM NaPO 4 pH 8 150 mM NaCl to remove any nonspecific aggregates Appropriate fractions were pooled and dialyzed against 1 liter of buffer G 10 mM NaPO 4 pH 8 0 CD spectra of nsp9 samples were gathered from 200 to 255 nm in a 1 mm pathlength quartz cuvette at 20 C 1 nm steps 50 nm s scan speed 4 s response time three scans using a Jasco J 715 Spectrapolarimeter Department of Pharmaceutical Sciences University at Buf falo Secondary structure assignment was achieved through use of the K2d web server www embl heidelberg de H11011andrade k2d and the DICHROWEB server www cryst bbk ac uk cdweb html home html 1 40 62 For thermal denaturation experiments using CD spectroscopy a similar pro tocol was followed Samples were monitored while heating from 20 to 95 C using a Peltier device Spectra were gathered at 5 intervals with peak monitoring at 205 nm The data were analyzed using Origin 7 0 RNA EMSA A labeled ssRNA oligonucleotide Integrated DNA Technolo gies was used for gel shift assays Biotin 5H11032 CGACUCAUGGACCUUGGCA G 3H11032 Oligonucleotide was resuspended in RNase free water at 1 H9262M and stored at H1100220 C 5 H9262g of nsp9 samples in buffer D were mixed with 1 H9262M RNA 1 H9262M ssDNA oligonucleotide 3CL NdeI Forward2 5H11032 GGTGGTCATATGAGTGG TTTTAGGAAAATGGCATT 3H11032 and RNase inhibitor SUPERaseIN Am bion followed by incubation for 60 min at room temperature After incubation the samples were cross linked at 254 nm for 15 min High density Tris borate EDTA TBE loading buffer Invitrogen was added to the nucleic acid protein mixtures which were loaded onto Novex 4 to 20 TBE polyacrylamide gels Invitrogen and resolved at 80 V for2hin0 5H11003 TBE buffer The gels were then transferred to positively charged nylon membrane Hybond in 0 5H11003 TBE at 25 V for 30H11032 in a semidry transfer apparatus Bio Rad Membranes were cross linked for 5 min in 2H11003 SSC 1H11003 SSC is 0 15 M NaCl plus 0 015 M sodium citrate at 254 nm The membranes were then developed using a BrightStar biodetection kit Ambion according to the manufacturer s protocol Extended wash steps were incorporated to help further decrease the nonspecific background of the membrane Attempts were also made to compete the RNA probe off of nsp9 using an ssDNA template which was added at equivalent and 10 fold higher levels com pared to the RNA probe Developed membrane was exposed to Hyperfilm ECL GE Healthcare and analyzed for electrophoretic mobility FA FA measurements were performed on a Fluoromax 4 spectrophotometer Jobin Yvon Horiba equipped with a temperature controlled cell and polarizing filters All experiments were carried out at 22 C 5H11032 Fluorescein labeled RNA 5H11032 FAM CGACUCAUGGACCUUGGCAG 3H11032 IDT was used in all experiments FAM RNA was dissolved in buffer 20 mM Tris pH 7 2 to a final concentration of 58 nM in a 1 ml quartz cuvette Small aliquots 1 to 2 H9262l of nsp9 or nsp9 mutants in 10 mM MES pH 5 6 were added to the cuvette covering a protein concentration range of 1 to 2 000 nM followed by incubation with stirring for 5 min between measurements FA was measured by exciting at 490 nm and mon itoring the emission at 515 nm Slits for the excitation and emission were set to 2 5 nm The integration time was 2 0 s for the anisotropy measurements FA data collection was controlled by using the FA module of the Fluoressence software version 2 1 5 0 Each anisotropy value is the average of 10 individual anisotropy measurements The relative standard deviation was H110212 for all measurements The data were analyzed using nonlinear regression fitting of the data to the following equation 42 for a single site binding model using Prism software AH11005A f H11001H20849A b H11002A f H20850 H11003H20875 1 H11001K a H20851L T H20852H11001K a H20851R T H20852H11002 H20881H20853H208491 H11001K a H20851L T H20852H11001K a H20851R T H20852H20850 2 H11002 4H20851L T H20852H20851R T H20852K a 2 H20854 2K a H20851R T H20852 H20876 ITC Dilution isothermal titration calorimetry ITC is a technique amenable to determining protein dimerization constants 7 9 Purified protein samples were subjected to buffer exchange five times in an Amicon centrifugal concen trator to exchange protein in appropriate buffer 20 mM MES pH 5 6 15 mM NaCl and 0 1 mM TCEP for wild type G100E and G104E 20 mM Na TAPS N Tris hydroxymethyl methyl 3 aminopropanesulfonic acid pH 8 5 100 mM MgCl 2 and 0 1 mM TCEP for G104V Protein samples and corresponding buffer were filtered to 0 2 H9262m Acrodisc syringe filter low protein binding HT Tuffryn membrane PALL Life Sciences and thoroughly degassed Buffer corresponding to the sample to be studied was loaded into the reference and sample cells of the VP ITC Microcal Typically 28 injections of 10 H9262lof protein were made into the sample cell filled with buffer Concentrations of nsp9 in the injection syringe ranged from 189 H9262M to 6 3 mM and concentration ranges in the sample cell were monitored from H110110 001 mM to H110110 3 mM near the published dimerization K d Additional measurements on samples were made up to a final concentration of H110111 mM within the sample cell Samples which showed a saturation curve were fit to a simple dissociation model using the included analysis software Origin 7 specifically designed for dilution ITC data analysis Mutant design for