【病毒外文文獻(xiàn)】2007 Human Coronavirus 229E Papain-Like Proteases Have Overlapping Specificities but Distinct Functions in Viral Replica

《【病毒外文文獻(xiàn)】2007 Human Coronavirus 229E Papain-Like Proteases Have Overlapping Specificities but Distinct Functions in Viral Replica》由會(huì)員分享，可在線閱讀，更多相關(guān)《【病毒外文文獻(xiàn)】2007 Human Coronavirus 229E Papain-Like Proteases Have Overlapping Specificities but Distinct Functions in Viral Replica（11頁(yè)珍藏版）》請(qǐng)?jiān)谘b配圖網(wǎng)上搜索。

JOURNAL OF VIROLOGY Apr 2007 p 3922 3932 Vol 81 No 8 0022 538X 07 08 00H110010 doi 10 1128 JVI 02091 06 Copyright 2007 American Society for Microbiology All Rights Reserved Human Coronavirus 229E Papain Like Proteases Have Overlapping Specificities but Distinct Functions in Viral Replication H17188 John Ziebuhr 1 Barbara Schelle 2 Nadja Karl 1 2 Ekaterina Minskaia 1 Sonja Bayer 2 Stuart G Siddell 3 Alexander E Gorbalenya 4 and Volker Thiel 5 Centre for Cancer Research and Cell Biology School of Biomedical Sciences The Queen s University of Belfast Belfast United Kingdom 1 Institute of Virology and Immunology University of Wu rzburg Wu rzburg Germany 2 Department of Cellular and Molecular Medicine School of Medical and Veterinary Sciences University of Bristol Bristol United Kingdom 3 Department of Medical Microbiology Leiden University Medical Center Leiden The Netherlands 4 and Research Department Kantonal Hospital St Gallen St Gallen Switzerland 5 Received 25 September 2006 Accepted 16 January 2007 Expression of the exceptionally large RNA genomes of CoVs involves multiple regulatory mechanisms including extensive proteolytic processing of the large replicase polyproteins pp1a and pp1ab by two types of cysteine proteases the chymotrypsin like main protease and papain like accessory proteases PL pro s Here we characterized the proteolytic processing of the human coronavirus 229E HCoV 229E amino proximal pp1a pp1ab region by two paralogous PL pro activities Reverse genetics data revealed that replacement of the PL2 pro active site cysteine was lethal By contrast the PL1 pro activity proved to be dispensable for HCoV 229E virus replication although reversion of the PL1 pro active site substitution to the wild type sequence after several passages in cell culture indicated that there was selection pressure to restore the PL1 pro activity Further experiments showed that both PL1 pro and PL2 pro were able to cleave the nsp1 nsp2 cleavage site with PL2 pro cleaving the site less efficiently The PL1 pro negative mutant genotype could be stably maintained in cell culture when the nsp1 nsp2 site was replaced by a short autoproteolytic sequence suggesting that the major driving force for the observed reversion of the PL1 pro mutation was the requirement for efficient nsp1 nsp2 cleavage The data suggest that the two HCoV 229E PL pro paralogs have overlapping substrate specificities but different functions in viral replication Within the tightly controlled interplay of the two protease activities PL2 pro plays a universal and essential proteolytic role that appears to be assisted by the PL1 pro paralog at specific sites Functional and evolutionary implications of the differential amino terminal polyprotein processing pathways among the main CoV lineages are discussed Expression of positive strand RNA virus genomes generally starts with the translation of the incoming viral RNA to pro duce large precursor proteins that are co and posttranslation ally processed by viral and in some cases cellular proteases The proteolytic release of intermediate and mature processing products which may have diverse functions in different phases of viral replication is spatially and temporally coordinated Protease activities can therefore be viewed as key regulators of the life cycles of positive strand RNA viruses The positive strand RNA coronaviruses CoVs have evolved a most complex pattern of polyprotein processing and regulation 64 66 The 5H11032 terminal two thirds of the giant 30 kb genome is occupied by two overlapping open reading frames ORFs called 1a and 1b which together form the viral replicase gene and whose translation results in the production of two large polyproteins ORF1a encodes polyprotein 1a pp1a and ORFs 1a and 1b encode pp1ab The biosynthesis of pp1ab involves a ribosomal frameshift at the ORF1a ORF1b junction during translation 9 10 As many as 15 or 16 processing end products which are called nonstructural proteins nsps are proteolytically released from pp1a pp1ab 64 66 Together with a number of cellular proteins 51 and the viral nucleocapsid N protein 1 49 the nsps are believed to form a membrane bound multienzyme com plex which is called the replicase transcriptase complex 47 52 The proteins located downstream i e carboxy terminal of nsp5 in pp1a pp1ab include key replicative enzymes of the virus such as RNA dependent RNA polymerase nsp12 12 RNA helicase nsp13 50 exoribonuclease nsp14 42 en doribonuclease nsp15 6 31 and putative methyltransferase nsp16 activities 53 64 They also include several small pro teins nsp7 to nsp10 which typically have RNA binding activ ities 18 32 40 56 63 and therefore are believed to be involved in viral RNA synthesis as well as the hydrophobic probably membrane spanning protein nsp6 Because of its key role in the proteolytic release of all these proteins the nsp5 associated cysteine protease activity is critically involved in viral replication and therefore is often referred to as the CoV main protease M pro 64 66 The nsp5 associated M pro has a chymotrypsin like fold that is fused to a unique carboxy terminal domain and displays a narrow substrate specificity that resembles that of picornavirus 3C proteases 2 3 21 66 The M pro mediated processing pathways are well conserved in all CoVs M pro cleaves as many as 11 pp1a pp1ab sites to produce a total of 13 mature proteins Consequently the pat terns of M pro mediated processing are likely to be very similar for all CoVs 64 Proteins upstream of nsp5 include i the hydrophobic membrane bound nsp4 ii two large multidomain proteins nsp2 and nsp3 and iii the amino terminal product nsp1 Corresponding author Mailing address Kantonal Hospital St Gallen Research Department 9007 St Gallen Switzerland Phone 41 71 4942843 Fax 41 71 4946321 E mail volker thiel kssg ch H17188 Published ahead of print on 24 January 2007 3922 which is found in most but not all CoVs Fig 1 The amino proximal pp1a pp1ab proteins nsp1 to nsp3 are relatively poorly conserved 53 67 and there is evidence that some of these proteins or their subdomains are not essential 11 25 43 Hence the nsp3 associated cysteine proteases PL1 pro and PL2 pro which control the proteolytic processing of this pp1a pp1ab region are also referred to as CoV accessory pro teases 64 66 nsp4 is sandwiched between the autoproteo lytically released proteins nsp3 and nsp5 and accordingly its release from pp1a pp1ab is under the control of both main and accessory proteases The multidomain protein nsp3 is the largest CoV replicative protein 67 It has a size of H110111 700 to 1 900 amino acids and includes one or two proteases called PL1 pro and PL2 pro that adopt a papain like fold with amino and carboxy terminal domains connected by a Zn ribbon structure 22 29 44 PL1 pro and PL2 pro reside upstream and downstream respec tively of the conserved ADP ribose 1H11033 phosphatase ADRP domain 19 22 43 46 53 whose biological function is not yet known Fig 1 Several other domains were provisionally iden tified in nsp3 with two of them an acidic Ac domain at the amino terminus and a Cys His rich domain at the carboxy terminus the Y domain being conserved in all CoVs 67 Also PL2 pro is conserved in all CoVs The protease is amino terminally extended by a small ubiquitin like Ubi domain that probably modulates the PL2 pro deubiquitinating activity 5 44 54 In contrast PL1 pro was identified only in CoVs belonging to genetic group 1 and subgroup 2a Subgroup 2b CoVs including severe acute respiratory syndrome SARS CoV do not encode a PL1 pro 39 45 53 60 whereas group 3 CoVs prototype infectious bronchitis virus IBV possess a PL1 pro remnant that lacks proteolytic activity 67 Besides differences in the domain organization of nsp1 to nsp3 there are also differences in the proteolytic processing pathways among the various groups and subgroups of CoVs Thus for example in the CoV groups 2b and 3 which specify a single papain like protease activity the PL2 pro activity is responsible for the processing of the entire amino proximal region to produce two or three mature proteins 27 36 37 60 These PL2 pro cleavage sites have three strictly conserved res idues at their P4 to P1 positions 60 By contrast in CoVs encoding two PL pro s the regulation of the proteolytic process ing pathways seems to be more complex For example in mouse hepatitis virus MHV the prototype of CoV group 2a PL1 pro cleaves the nsp1 nsp2 and nsp2 nsp3 sites while PL2 pro cleaves the nsp3 nsp4 site 4 7 8 15 24 34 57 Accordingly the MHV PL1 pro and PL2 pro cleavage sites resemble each other only remotely in that both of them have small amino acid residues at their P2 and or P1 positions In human CoV 229E HCoV 229E a group 1 CoV the situation is again different Here the nsp1 nsp2 site was reported to be processed by PL1 pro whereas the nsp2 nsp3 site can be processed by either PL1 pro or PL2 pro with PL2 pro being the dominant activity 28 67 Accordingly these sites and the yet to be verified HCoV 229E nsp3 nsp4 site are more similar to each other resem bling the situation found in CoVs encoding just one active PL pro 60 In this study we have characterized the proteolytic regula FIG 1 CoV PL pro mediated polyprotein processing The pp1a pp1ab amino terminal regions of HCoV 229E group 1 MHV group 2a SARS CoV SCoV group 2b and IBV group 3 are shown with the previously identified processing end products nsp1 to nsp4 and the corresponding cleavage sites P1 and PH11032 residues are indicated The sites processed by specific protease domains are indicated by arrows P1 and PH11032 residues are given Ac acidic domain PL1 papain like protease 1 X ADP ribose 1H11033phosphatase PL2 papain like protease 2 Y domain with conserved Cys His residues and putative transmembrane regions SUD SARS CoV specific domain VOL 81 2007 CORONAVIRUS PAPAIN LIKE PROTEINASE FUNCTION 3923 tion of HCoV 229E nsp1 synthesis using reverse genetics The HCoV 229E nsp1 belongs to an uncharacterized protein family that is conserved in group 1 CoVs It is distinct from the nsp1 protein family of group 2 CoVs which was recently shown for MHV to affect diverse host cell functions 33 In our study we sought to answer the question of whether and to what extent the two PL pro activities were involved in the proteolytic release of nsp1 We used the HCoV 229E reverse genetics system 58 to produce mutants in which one of the protease activities either PL1 pro or PL2 pro was abolished by codon mutagenesis of the active site nucleophile The data show that inactivation of PL2 pro is lethal whereas the PL1 pro activity is dispensable for HCoV 229E replication as demonstrated by Northern blot analysis of viral RNA synthesis and the rescue of a viable PL1 pro negative mutant However upon passage in cell cul ture the PL1 pro negative mutant reverted to the wild type sequence indicating selective pressure to restore the PL1 pro activity Our further analysis revealed that PL2 pro is able to cleave the nsp1 nsp2 site although less efficiently than does PL1 pro Finally by uncoupling cleavage of the nsp1 nsp2 site from the two PL pro activities we managed to stably maintain the PL1 pro negative mutant genotype in cell culture This sug gests that the major driving force for the reversion of the PL1 pro mutation was the requirement for an efficient cleavage of the nsp1 nsp2 site Taken together our data provide further evidence for overlapping substrate specificities of the PL1 pro and PL2 pro domains in HCoV 229E In this functional coop eration the essential PL2 pro domain plays a major and clearly dominant proteolytic role whereas the dispensable paralogous PL1 pro may have evolved to at least partially liberate the PL2 pro domain from its role in efficient nsp1 nsp2 processing MATERIALS AND METHODS Viruses and cells MRC 5 and CV 1 cells were purchased from the European Collection of Cell Cultures D980R cells were a kind gift from G L Smith Imperial College London United Kingdom BHK HCoV N cells expressing the HCoV 229E nucleocapsid protein under the control of the TET ON system Clontech have been described previously 49 62 All cells were maintained in minimal essential medium supplemented with fetal bovine serum 5 to 10 and antibiotics HCoVs and recombinant vaccinia viruses were propagated titrated and purified as described previously 58 Cloning of plasmid DNAs and recombinant vaccinia viruses To generate recombinant vaccinia viruses the following plasmid DNAs were constructed using standard procedures The details of construction and plasmid maps and sequences are available from the authors upon request To construct the recombinant vaccinia virus vHCoV PL1 pro H11002 two DNA fragments designated EB PL1 pro H11002 and BF were produced These fragments together include HCoV 229E nucleotides nt 1 to 7006 The first fragment EB PL1 pro H11002 includes HCoV 229E nt 1 to 5207 contains the PL1 pro active site Cys1054Ala mutation and was constructed as follows Plasmid DNA pEB car rying HCoV 229E nucleotides 1 to 5207 preceded by one additional G nucleotide and the T7 RNA polymerase promoter 59 was modified to introduce the PL1 pro active site Cys1054Ala mutation Briefly two PCRs were done using the vHCoV inf 1 DNA 58 as a template PCR1 PL1 pro H11002 was done using primers OLV1 53 5H11032 1221 TTGAAGGTGTCTCTGTTTGGAGAGTGAT 1248 3H11032 and JZ212 5H11032 TATAGGTCTCAGGCGTTGTTATCCAATTGTTTGAGTA TC 3427 3H11032 the BsaI restriction site is in italics and the antisense Ala1054 codon is underlined PCR2 PL1 pro H11002 was done using primers JZ213 5H11032 TATAGGT CTCACGCCTGGGTTAACTCAGTTATGTTACAA 3478 3H11032 the BsaI restric tion site is in italics and the Ala1054 codon is underlined and Oli148 5H11032 4218 GCAAGGTTCTCATTAGC 4202 3H11032 Both PCR products were cleaved with BsaI and ligated using T4 DNA ligase The resulting ligation product was cleaved with SapI and Bsu36I and used to replace the corresponding SapI Bsu36I fragment of plasmid DNA pEB The resulting plasmid DNA designated pEB PL1 pro H11002 was verified by sequence analysis Plasmid DNA pEB PL1 pro H11002 was then cleaved with EagI and BglII and treated with alkaline phosphatase and the DNA fragment EB PL1 pro H11002 containing HCoV 229E nt 1 to 5207 with the Cys1054Ala change was gel purified The second DNA fragment BF encom passes HCoV 229E nt 5176 to 7006 59 and was generated using primers Bgl up 5H11032 5176 AGTTGGTGTTATTGCTGATAAGGAC 5200 3H11032 and Fse down 5H11032 7006 GACATAGGCCGGCCCTGTTGGTTGCACATTTGTTTTGGT 6968 3H11032 The PCR product PCR BF was cleaved with BglII and the resulting DNA fragment BF was ligated to the DNA fragment EB PL1 pro H11002 The ligation product EB PL1 pro H11002 BF was cleaved with FseI purified and subsequently used in an in vitro ligation reaction with NotI cleaved vaccinia virus vNotI tk genomic DNA 41 and FseI cleaved vaccinia virus vHCoV inf 1 DNA To rescue recombinant vaccinia virus vHCoV PL1 pro H11002 the ligation reaction was transfected without further purification into fowlpox infected CV 1 cells as described previously 58 To identify a correct vHCoV PL1 pro H11002 clone the recombinant vaccinia virus clones obtained were analyzed by Southern blotting PCR and sequence analysis of HCoV 229E nt 1 to 7100 The recombinant vaccinia virus vHCoV PL2 pro H11002 was constructed similarly to the recombinant vaccinia virus vHCoV PL1 pro H11002 by in vitro ligation First plasmid DNA pEB see above was cleaved with EagI and BglII and treated with alkaline phosphatase and the resulting DNA fragment EB HCoV 229E nt 1 to 5207 was gel purified The DNA fragment PCR BF encompassing HCoV 229E nt 5176 to 7006 59 was modified to introduce the PL2 pro active site Cys1701Ala mutation as follows PCR1 PL2 pro H11002 was done with primers Bgl up and JZ214 5H11032 TATAGGTCTCAATGCATTATTATCACTAGTTTTTAACAC 3H11032 the BsaI restriction site is in italics and the antisense Ala1701 codon is under lined PCR2 PL2 pro H11002 was done using primer JZ215 5H11032 TATAGGTCTCAG CATGGGTGAATGCTGTTTGTATTGCAC 5420 3H11032 the BsaI restriction site is in italics and the Ala1701 codon is underlined and primer Fse down Both PCR products were cleaved with BsaI and ligated The resulting ligation product BF PL2 pro H11002 was cleaved with BglII and ligated to DNA fragment EB The resulting ligation product EB BF PL2 pro H11002 was cleaved with FseI purified and used in an in vitro ligation reaction with NotI cleaved vaccinia virus vNotI tk genomic DNA and FseI cleaved vaccinia virus vHCoV inf 1 DNA To rescue recombinant vaccinia virus vHCoV PL2 pro H11002 the ligation reaction was trans fected without further purification into fowlpox infected CV 1 cells To identify a correct vHCoV PL2 pro H11002 clone the recombinant vaccinia virus clones ob tained were analyzed by Southern blotting PCR and sequence analysis of HCoV 229E nt 1 to 7100 To construct the recombinant vaccinia viruses vPL1 H11001 PL2 H11001 vPL1 H11002 PL2 H11001 and vPL1 H11001 PL2 H11002 we first generated two plasmid DNAs desig nated p7E1N and pFse3C Plasmid DNA p7E1N was based on pBluescipt KS H11001 Stratagene and contained the bacteriophage T7 RNA polymerase promoter the encephalomyocarditis virus internal ribosomal entry site EMCV IRES and HCoV 229E nt 293 to 1485 Plasmid DNA pFse 3C contained HCoV 229E nt 6993 to 9187 a TAA stop codon the HCoV 229E 3H11032 end nt 27221 to 27277 a synthetic poly A sequence of 37 nt and an EagI restriction site The vaccinia virus inserts were assembled by in vitro ligation using three DNA fragments Fragment 1 contained the T7 RNA polymerase promoter the EMCV IRES element and HCoV 229E nt 293 to 1260 and was prepared from plasmid DNA p7E1N by EagI and SapI cleavage alkaline phosphatase treatment and gel purification Three versions of fragment 2 encompassing HCoV 229E nt 1261 to 6995 were prepared by PCR using vaccinia virus genomic DNAs from vHCoV inf 1 vHCoV PL1 pro H11002 and vHCoV PL2 pro H11002 respectively as templates and subsequently cleaved with SapI and FseI Depending on the DNA template used for PCR the different versions of fragment 2 encoded either i two active PL pro s ii an inactive PL1 pro and an active PL2 pro or iii an active PL1 pro and an inactive PL2 pro Fragment 3 was prepared from plasmid DNA pFse3C by FseI and EagI cleavage alkaline phosphatase treatment and gel purification and encompassed HCoV 229E nt 6996 to 9187 a TAA stop codon HCoV 229E nt 27221 to 27277 and a synthetic poly A sequence of 37 nt After in vitro ligation of fragments 1 2 and 3 the ligation products were ligated to NotI cleaved vaccinia virus vNotI tk genomic DNA Rescue of recombinant vaccinia viruses vPL1 H11001 PL2 H11001 vPL1 H11002 PL2 H11001 and vPL1 H11001 PL2 H11002 was done by trans fection of the ligation products into fowlpox infected CV 1 cells The identities of recombinant vaccinia virus clones were confirmed by Southern blotting and sequence analysis Construction of recombinant vaccinia virus vHCoV TaV PL1 pro H11002 was done by vaccinia virus mediated homologous recombination using the Escherichia coli guanine phosphoribosyltransferase gpt gene as a marker for positive and neg ative selection as described previously 30 We used plasmid DNA pRec 2 30 for recombination with vHCoV PL1 pro H11002 resulting in the gpt positive clone vHCoV PL1 pro H11002 Rec 2 The second recombination was done with vHCoV PL1 pro H11002 Rec 2 and plasmid DNA pEx2 TaV which contains a 500 nt HindIII 3924 ZIEBUHR ET AL J VIROL NotI fragment derived from vaccinia virus vNotI tk the T7 RNA polymerase promoter one G nucleotide HCoV 229E nt 1 to 616 the sequence encoding the Thosea asigna virus 2A like autoprocessing peptide 16 and HCoV 229E nt 626 to 3323 The identity of the resulting recombinant vaccinia virus clone vHCoV TaV PL1 pro H11002 was verified by Southern blotting and sequence analysis of the region where recombination had occurred Rescue of recombinant HCoV 229E and HCoV 229E mutants In vitro tran scription from reco